Long (dA)n.(dT)n tracts can form intramolecular triplexes under superhelical stress.

نویسنده

  • K R Fox
چکیده

Plasmids containing long tracts of (dA)n.(dT)n have been prepared and their conformations examined in linear and supercoiled DNA using a series of chemical and enzymic probes which are known to be sensitive to unusual DNA structures. Under superhelical stress and in the presence of magnesium the sequence T69.A69 adopts a conformation at pH 8.0 consistent with the formation of an intramolecular DNA triplex. Site specific cleavage of the supercoiled plasmid by single-strand specific nucleases occurs within the A.T insert; the 5'-end of the purine strand is sensitive to reaction with diethylpyrocarbonate while the central 5-6 bases of the pyrimidine strand are reactive to osmium tetroxide. By contrast shorter inserts of A33.T33 and A23.T23 do not appear to form unusual structures.

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Left-handed Z-DNA and intramolecular triplex formation at the site of an unequal sister chromatid exchange.

An unequal sister chromatid exchange (USCE) in the mouse myeloma cell line MPC-11 between 3' regions of the C gamma 2a and C gamma 2b heavy chain genes results in duplication of the C gamma 2a heavy chain gene and generation of a novel recombination joint. The USCE occurs between (TC)n tracts adjacent to alternating purine-pyrimidine tracts. We have investigated the capacity of both the donor r...

متن کامل

Sequences near the origin of replication of the DHFR locus of Chinese hamster ovary cells adopt left-handed Z-DNA and triplex structures.

The earliest replicating portion of the Chinese hamster dihydrofolate reductase domain contains a cluster of simple repeated sequences 180 base pairs long composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 '. Previous nuclease sensitivity and intermolecular hybridization studies suggested that the two long (AG) repeats in this tract formed intramolecular DNA triplexes in n...

متن کامل

PKD1 intron 21: triplex DNA formation and effect on replication.

Although autosomal dominant polycystic kidney disease is transmitted in an autosomal dominant fashion, there is evidence that the pathophysiology of cystogenesis involves a second hit somatic mutation superimposed upon the inherited germline mutation within the renal tubule cells. The polypurine.polypyrimidine (Pu.Py) tract of PKD1 intron 21 may play a role in promoting somatic mutations. To be...

متن کامل

Formation of (dA-dT)n cruciforms in Escherichia coli cells under different environmental conditions.

We have detected cruciform formation of (dA-dT)n inserts in Escherichia coli cells by analyzing the superhelical density of isolated plasmid DNA samples and by probing intracellular DNA with chloroacetaldehyde. The plasmids we used were pUC19 containing inserts of (dA-dT)n. The cruciforms appeared after cells underwent different stresses: inhibition of protein synthesis, anaerbiosis, and osmoti...

متن کامل

Altered gene expression correlates with DNA structure.

We examined the participation of triplex DNA structure in gene regulation using a poly(dG)-poly(dC) sequence as a model. We show that a poly(dG)-poly(dC) sequence, which can adopt an intramolecular dG.dG.dC triplex under superhelical strain, strongly augments gene expression when placed 5' to a promoter. The activity of this sequence exhibits a striking length dependency: dG tracts of 27-30 bp ...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

عنوان ژورنال:
  • Nucleic acids research

دوره 18 18  شماره 

صفحات  -

تاریخ انتشار 1990